View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_21 (Length: 264)
Name: NF14146_high_21
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 16128105 - 16127883
Alignment:
| Q |
18 |
agagaaaagaggagaaagtgtcgttgtttagggtcttagcgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16128105 |
agagaaaagaggagaaagtgtcgtggtttagggttttagcgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag |
16128006 |
T |
|
| Q |
118 |
gcaagtgatgacgcgttgccggaggttgggaggagtggtggcggtgagttgcggtgggccgctgagggagtggcgacgtgaggacattgtcgtcttttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16128005 |
gcaagtgatgacgcgttgccggaggttgggaggagtggtggcggtgagttgcggtgggccgctgagggagtggcgacgtgaggacattgtcgtcttttcg |
16127906 |
T |
|
| Q |
218 |
tgaggttagtgtcttagcattcg |
240 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
16127905 |
tgaggttagtgtctcggcattcg |
16127883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 29575548 - 29575488
Alignment:
| Q |
57 |
cgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag |
117 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |||||||||||| ||| |||| ||||||||| |
|
|
| T |
29575548 |
cgatggatttgagtttgacggtggcgccgacgagtgtgtcgcagtcagagactttgttgag |
29575488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 107
Target Start/End: Complemental strand, 36575592 - 36575528
Alignment:
| Q |
43 |
gtttagggtcttagcgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggaga |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
36575592 |
gtttagcgttttagcgatggattcgagttcaacggtggcgccaaacactgtgtcgcggtcggaga |
36575528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 31694908 - 31694968
Alignment:
| Q |
57 |
cgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag |
117 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |||||||||||| ||| |||| ||||||||| |
|
|
| T |
31694908 |
cgatggatttgagtttgacggtggcgccgacgagtgtgtcgcagtcagagactttgttgag |
31694968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 43 - 85
Target Start/End: Complemental strand, 43236899 - 43236857
Alignment:
| Q |
43 |
gtttagggtcttagcgatggattcgagttcgacggtggcgccg |
85 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
43236899 |
gtttagagttttagcgatggattcgagttcgacggtggcgccg |
43236857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 22881607 - 22881664
Alignment:
| Q |
60 |
tggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag |
117 |
Q |
| |
|
|||||| ||||| ||||||| ||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
22881607 |
tggatttgagtttgacggtgacgccgacaagtgtgtcgcaatcggagagtttgttgag |
22881664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 22933271 - 22933328
Alignment:
| Q |
60 |
tggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag |
117 |
Q |
| |
|
|||||| ||||| ||||||| ||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
22933271 |
tggatttgagtttgacggtgacgccgacaagtgtgtcgcaatcggagagtttgttgag |
22933328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University