View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14146_high_21 (Length: 264)

Name: NF14146_high_21
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14146_high_21
NF14146_high_21
[»] chr5 (1 HSPs)
chr5 (18-240)||(16127883-16128105)
[»] chr8 (2 HSPs)
chr8 (57-117)||(29575488-29575548)
chr8 (43-107)||(36575528-36575592)
[»] chr7 (1 HSPs)
chr7 (57-117)||(31694908-31694968)
[»] chr2 (1 HSPs)
chr2 (43-85)||(43236857-43236899)
[»] chr4 (2 HSPs)
chr4 (60-117)||(22881607-22881664)
chr4 (60-117)||(22933271-22933328)


Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 16128105 - 16127883
Alignment:
18 agagaaaagaggagaaagtgtcgttgtttagggtcttagcgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag 117  Q
    |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16128105 agagaaaagaggagaaagtgtcgtggtttagggttttagcgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag 16128006  T
118 gcaagtgatgacgcgttgccggaggttgggaggagtggtggcggtgagttgcggtgggccgctgagggagtggcgacgtgaggacattgtcgtcttttcg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16128005 gcaagtgatgacgcgttgccggaggttgggaggagtggtggcggtgagttgcggtgggccgctgagggagtggcgacgtgaggacattgtcgtcttttcg 16127906  T
218 tgaggttagtgtcttagcattcg 240  Q
    ||||||||||||||  |||||||    
16127905 tgaggttagtgtctcggcattcg 16127883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 29575548 - 29575488
Alignment:
57 cgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag 117  Q
    ||||||||| ||||| ||||||||||||| |||||||||||| ||| |||| |||||||||    
29575548 cgatggatttgagtttgacggtggcgccgacgagtgtgtcgcagtcagagactttgttgag 29575488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 107
Target Start/End: Complemental strand, 36575592 - 36575528
Alignment:
43 gtttagggtcttagcgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggaga 107  Q
    |||||| || |||||||||||||||||||| |||||||||||    | |||||||||||||||||    
36575592 gtttagcgttttagcgatggattcgagttcaacggtggcgccaaacactgtgtcgcggtcggaga 36575528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 31694908 - 31694968
Alignment:
57 cgatggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag 117  Q
    ||||||||| ||||| ||||||||||||| |||||||||||| ||| |||| |||||||||    
31694908 cgatggatttgagtttgacggtggcgccgacgagtgtgtcgcagtcagagactttgttgag 31694968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 43 - 85
Target Start/End: Complemental strand, 43236899 - 43236857
Alignment:
43 gtttagggtcttagcgatggattcgagttcgacggtggcgccg 85  Q
    |||||| || |||||||||||||||||||||||||||||||||    
43236899 gtttagagttttagcgatggattcgagttcgacggtggcgccg 43236857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 22881607 - 22881664
Alignment:
60 tggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag 117  Q
    |||||| ||||| ||||||| ||||| | ||||||||||  |||||||||||||||||    
22881607 tggatttgagtttgacggtgacgccgacaagtgtgtcgcaatcggagagtttgttgag 22881664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 22933271 - 22933328
Alignment:
60 tggattcgagttcgacggtggcgccggcgagtgtgtcgcggtcggagagtttgttgag 117  Q
    |||||| ||||| ||||||| ||||| | ||||||||||  |||||||||||||||||    
22933271 tggatttgagtttgacggtgacgccgacaagtgtgtcgcaatcggagagtttgttgag 22933328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University