View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_24 (Length: 253)
Name: NF14146_high_24
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 235
Target Start/End: Complemental strand, 2443142 - 2442909
Alignment:
| Q |
8 |
ggagaagcaaagggagaatgagcgccgaaggattcttatggacgaagttgagaagcagcagaatgacaaggattggtggaaacgcttgaataataaaatc |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443142 |
ggagaagaaaagggagaatgagcgccgaaggattcttatggacgaagttgagaagcagcagaatgacaaggattggtggaaacgcttgaataataaaatc |
2443043 |
T |
 |
| Q |
108 |
actgaaagatggacaaactctaggtaaattttgagcccattttacgttattttgattcaatt------agatgcttaaaattgtatattttgagtcaatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2443042 |
actgaaagatggacaaactctaggtaaattttgagcccattttacgttattttgattcaattagatttagatgcttaaaattgtatattttgagtcaatt |
2442943 |
T |
 |
| Q |
202 |
ttaggtgattttgattccaatacatgcttaaatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2442942 |
ttaggtgattttgattccaatacatgcttaaatt |
2442909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University