View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_28 (Length: 238)
Name: NF14146_high_28
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 209
Target Start/End: Original strand, 14546161 - 14546364
Alignment:
| Q |
7 |
ttccagctcatagagacacgtatcatgcttaatctgttaaagtttctgttacgaaaatttatacagaaaatacattcaatgaagtaagtttgtttctatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14546161 |
ttccagctcatagagacacgtatcatgcttaatctgttaaagtttctgttaagaaaatttatacagaaaatacattcaatgaagtaagtttgtttctatt |
14546260 |
T |
|
| Q |
107 |
cataaatcatgacatactaacaatgtgttgaatattgcatgacttcttgtgggtttatc-tttttagtttctatgtaagtcaaggaaacatattttgcag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
14546261 |
cataaatcatgacatactaacaatgtgttgaatattgcatgacttcttgtgggtttatcttttttagtttctatgcaagtcaaggaaacaaattttgcag |
14546360 |
T |
|
| Q |
206 |
tgaa |
209 |
Q |
| |
|
|||| |
|
|
| T |
14546361 |
tgaa |
14546364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University