View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14146_high_29 (Length: 236)

Name: NF14146_high_29
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14146_high_29
NF14146_high_29
[»] chr5 (1 HSPs)
chr5 (1-221)||(16128141-16128361)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16128141 - 16128361
Alignment:
1 ccggttcgtaaacaatgcgttaacctcttaactcttctttcgaagtttcacggtgacgctctttcgccatttttgtcgaaaatgattgctactgttcttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16128141 ccggttcgtaaacaatgcgttaacctcttaactcttctttcgaagtttcacggtgacgctctttcgccatttttgtcgaaaatgattgctactgttcttc 16128240  T
101 gtcgcattcatgatccggatactgttgttagatctgcttgtgttgaagctgtggcggaaatgtcgttaaggattactcgaccggcgttttcggttgcgtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
16128241 gtcgcattcatgatccggatactgttgttagatctgcttgtgttgaagctgtggcggaaatgtcgttaaggattactcgaccggcgtttgcggttgcgtt 16128340  T
201 tttaaggccgtttatggaggc 221  Q
    ||| |||||||||||||||||    
16128341 tttgaggccgtttatggaggc 16128361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University