View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_30 (Length: 235)
Name: NF14146_high_30
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29783747 - 29783526
Alignment:
| Q |
1 |
aatagaaaatgatgttagaaagtaaacggccacaaagaatgcaattgtacctcgttctggagttttgtttgagctcccagctgggatccctctccataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29783747 |
aatagaaaatgatgttagaaagtaaacggccacaaagaatgcaattgtacctcgttctggagttttgtttgagctcccagctgggatccctctccataag |
29783648 |
T |
 |
| Q |
101 |
tcatgtgggctgcatgtgtttgagatggtggaacttagaagctttgcactggagaagaggatgcattcattggtccaccggggatcacaaactgctttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29783647 |
tcatgtgggctgcatgtgtttgagatggtggaacgtagaagctttgcactggagaagaggacgcattcattggtccaccggggatcacaaactgcttttg |
29783548 |
T |
 |
| Q |
201 |
tgcttgctcattggaaacttgt |
222 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
29783547 |
tgcttgctcactggaaacttgt |
29783526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29787754 - 29787533
Alignment:
| Q |
1 |
aatagaaaatgatgttagaaagtaaacggccacaaagaatgcaattgtacctcgttctggagttttgtttgagctcccagctgggatccctctccataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29787754 |
aatagaaaatgatgttagaaagtaaacggccacaaagaatgcaattgtacctcgttctggagttttgtttgagctcccagctgggatccctctccataag |
29787655 |
T |
 |
| Q |
101 |
tcatgtgggctgcatgtgtttgagatggtggaacttagaagctttgcactggagaagaggatgcattcattggtccaccggggatcacaaactgctttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29787654 |
tcatgtgggctgcatgtgtttgagatggtggaacgtagaagctttgcactggagaagaggacgcattcattggtccaccggggatcacaaactgcttttg |
29787555 |
T |
 |
| Q |
201 |
tgcttgctcattggaaacttgt |
222 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
29787554 |
tgcttgctcactggaaacttgt |
29787533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University