View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14146_high_33 (Length: 213)
Name: NF14146_high_33
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14146_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 2160870 - 2161045
Alignment:
| Q |
19 |
agactttggtatatgccagcaaaattgaggagataaggttgagtttgggattcggattcgatgcagcatttgcacttgacagaatgagaagaattggtgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2160870 |
agactttggtatatgccagcaaaattgaggagataaggttgagtttgggattcggattcgatgcagcatttgcacttgacagaatgagaagaatcggtgg |
2160969 |
T |
 |
| Q |
119 |
gttttgaatggtcgctacaatggcactcatcaaattttattgacctggatgacactttacatgtttctatcgtttc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2160970 |
gttttgaatggtcgctacaatggcactcatcaaattttattgacctggatgacactttacatgtttctatcgtttc |
2161045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University