View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14147_high_7 (Length: 273)
Name: NF14147_high_7
Description: NF14147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14147_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 48942857 - 48942594
Alignment:
| Q |
1 |
agagacagcaacggcgacggcgagctggccaaggccgcttccgcctaagccggtgacgatttgatgaacctttttcccaccaaaaaccaccattatcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48942857 |
agagacagcaacggcgacggcgagctggccaaggccgcttccgcctaagccggtgacgatttgatgaacctttttcccaccgaaaaccaccattatcgtt |
48942758 |
T |
 |
| Q |
101 |
tccgtctgaagtttcggtagtgactagt----------gaagtttgagcttggaacagagaaatgagaatgaggaaaaataaaaatcagagtaaaaacga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48942757 |
tccgtctgaagtttcggtagtgactagtgaagggaagtgaagtttgagcttgaaacagagaaatgagaatgaggaaaaataaaaatcagagtaaaaacga |
48942658 |
T |
 |
| Q |
191 |
cggcgttttgtgagtgaagagcatgggtgacacgtgttaatttgtgtgtgtagatagataagac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48942657 |
cggcgttttgtgagtgaagagcatgggtgacacgtgttaatttgtgtgtgtagatagataagac |
48942594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University