View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14147_low_4 (Length: 386)
Name: NF14147_low_4
Description: NF14147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14147_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 343; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 48942845 - 48943216
Alignment:
| Q |
1 |
cgttgctgtctctttccttgttcgtatcttctctgcacccggtcccgctctcttaccggaaaacgacgtcgacgacgatgttccaatcaacgacgatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48942845 |
cgttgctgtctctttccttgttcgtatcttctctgcacccggtcccgctctcttaccggaaaacgacgtcgacgacgatgttccaatcaacgacggtgaa |
48942944 |
T |
 |
| Q |
101 |
actcctccttccaccggaaaggttactccggtcacaatccgttggaacaatattaattgttcactttctgataaatcctccaagtccgtgagtttctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48942945 |
actcctccttccaccggaaaggttaccccggtcacaatccgttggaacaatattaattgttcactttctgataaatcctccaagtccgtgagtttctatt |
48943044 |
T |
 |
| Q |
201 |
ccttctctctctctgtaaatgctgaattagttgctaagaaaatcagaatctaacagtgtgaggaaaaatcgttgtaatagtcttggatatttattgtatc |
300 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48943045 |
cct--tctctctctgtaaatgctgaattagttgctgagaaaatcagaatctaacagtgtgaggaaaaatcgttgtaatagtcttggatatttattgtatc |
48943142 |
T |
 |
| Q |
301 |
tttgcatgcacgtggttctgttgcttttatagagattttggatgtttgtttttgaagtttgattttggtgatga |
374 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48943143 |
gttgcatgcacgtggttctgttggttttatagagattttggatgtttgtttttgaagtttgattttggtgatga |
48943216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 217 - 374
Target Start/End: Complemental strand, 28638202 - 28638045
Alignment:
| Q |
217 |
aaatgctgaattagttgct-aagaaaatcagaatctaacagtgtgaggaaaaatcgttgtaatagtcttggatatttattgtatctttgcatgcacgtgg |
315 |
Q |
| |
|
|||| ||||||| |||||| || ||||| |||||||| |||||||||||||||| ||||| | |||||| |||||| ||| |||||||||||| | |
|
|
| T |
28638202 |
aaatcctgaattggttgctgaaaaaaattagaatctagtagtgtgaggaaaaatcattgtatttactttggatgtttattttattgttgcatgcacgtag |
28638103 |
T |
 |
| Q |
316 |
ttctgttgcttttatagagattttggatgtttgtttttgaagtttgattttggtgatga |
374 |
Q |
| |
|
|| ||||||||| || ||||||||| || |||||||||||||||||| ||| ||||||| |
|
|
| T |
28638102 |
ttgtgttgcttt-atggagattttgaatttttgtttttgaagtttgaattttgtgatga |
28638045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University