View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14147_low_6 (Length: 332)
Name: NF14147_low_6
Description: NF14147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14147_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 12 - 131
Target Start/End: Original strand, 52258527 - 52258645
Alignment:
| Q |
12 |
atgcaactaaatattttccttttaactatatatatcaatactatggtgtataagtgagacttgtattttgtacaaatttgttttcactaccaaattaata |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52258527 |
atgcaactaaatattttccttt-aactatatatatcaatactatggtgtataagtgagccttgtattttgtacaaattagttttcactaccaaattaata |
52258625 |
T |
 |
| Q |
112 |
attttcatcattatttcata |
131 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
52258626 |
aatttcatcattatttcata |
52258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 181 - 316
Target Start/End: Original strand, 52258646 - 52258784
Alignment:
| Q |
181 |
ctggtgcaatatcattta---tacaaaaccttaactataataatattttagggatatgtgtggccactgttttagtgnnnnnnnnccctgaaatttgtga |
277 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52258646 |
ctggtgaaatatcatttactatacaaaaccttaactataataatattttagggatatgtgtggccactgttttagtgtttttttcccctgaaatttgtga |
52258745 |
T |
 |
| Q |
278 |
gccaatcaatagtaagcttaagctatggtataaaacaaa |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52258746 |
gccaatcaatagtaagcttaagctatggtataaaacaaa |
52258784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University