View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14148_high_10 (Length: 282)
Name: NF14148_high_10
Description: NF14148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14148_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 39143681 - 39143931
Alignment:
| Q |
13 |
gtgagaagaaaaacttcaaaagaggtttgtttgaccatatctaaaggacgtgtatgtagatgtagtcaagtaatgccgccaaatatttgctgtgttagtg |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39143681 |
gtgagaagaaaaacctcaaaagaggtttgtttgagcatatctaaaggacgtgtatgtagatgtagtcaagtaatgccgccaaatatttgctgtgttagtg |
39143780 |
T |
 |
| Q |
113 |
gataggcaatgaagcaaagcaacttggacggttttgtttgtgagtgnnnnnnnctagccgtataattaagaccagagcttgttgagtagacgaaagaatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39143781 |
gataggcaatgaagcaaagcaacttggacggttttgtttgtgagtgaaaaaaactagccgtataattaagaccagagcttgttgagtagacgaaagaatc |
39143880 |
T |
 |
| Q |
213 |
tggttcctaatttgtcggatactactattttggtttgacatgtgaatcagc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39143881 |
tggttcctaatttgtcggatactactattttggtttgacatgtgaatcagc |
39143931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University