View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14148_high_12 (Length: 251)
Name: NF14148_high_12
Description: NF14148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14148_high_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 40455015 - 40454795
Alignment:
| Q |
16 |
gaagatggacggttataaagcaagcaccaaggcatatat--gcctccaaaaagttaaaccaataatcacttctgaacaaacgggtgatattttatttgta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40455015 |
gaagatggacggttataaagcaagcaccaaggcatatatatgcctccaaaaagttaaaccaataatcacttctgaacaaacgggtgatattttatttgta |
40454916 |
T |
 |
| Q |
114 |
tcatattctatagttattttttatactaaaaaccgtgtactatcaacaactatgcccgcacgatataatcaacaccatattattattattatagtataga |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40454915 |
tcatattctatagttattttttat--------------actatcaacaactatgcccgcacgatataatcaacacca---tattattattatagtataga |
40454833 |
T |
 |
| Q |
214 |
aagagagataataattgagattttccaaacacttctag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40454832 |
aagagagataataattgagattttccaaacacttctag |
40454795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University