View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14148_low_11 (Length: 275)
Name: NF14148_low_11
Description: NF14148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14148_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 14 - 260
Target Start/End: Complemental strand, 32316341 - 32316095
Alignment:
| Q |
14 |
ataaaagagagttttaaggattgatggattttggatatggtgagattgagtaatggttgagaagttgttaaagaacatatatttaaggagatggaatttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
32316341 |
ataaaagagagttttaaggattgatggattttggatatggtgagattgagtaatggttgagaagttgttgaagaacatacgtttaaggagatggaatttg |
32316242 |
T |
|
| Q |
114 |
tttcccattctgagattggtggaagattttgaatccagcaaaatacatcaggaaaactgaaagccattggattaattggaagaaattacttcaattaatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32316241 |
tttcccattctgagattggtggaagattttgaatccagcaaaatacatcaggaaaactgaaagccattggattaattggaagaaattacttcaattaatt |
32316142 |
T |
|
| Q |
214 |
caacttatatagtttaactctgtttgtaggtgcacttggttgaggct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32316141 |
caacttatatagtttaactctgtttgtaggtgcacttggttgaggct |
32316095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University