View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14148_low_15 (Length: 244)
Name: NF14148_low_15
Description: NF14148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14148_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 34741801 - 34741859
Alignment:
| Q |
1 |
tagttgttttaacttataatcatatttgaatatttgtgaccgtcaatattcgataagca |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34741801 |
tagttgttttaacttataatcatatttgaatatttgtgaccgtcaatattcgataagca |
34741859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 188
Target Start/End: Original strand, 49443608 - 49443641
Alignment:
| Q |
155 |
gatttgaagtttgtaccttgaggttacaaggcta |
188 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
49443608 |
gatttgaactttgtaccttgaggttacaaggcta |
49443641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 20159459 - 20159511
Alignment:
| Q |
169 |
accttgaggttacaaggctaggttctaatcattgaggtagcacctcaagtgta |
221 |
Q |
| |
|
|||||||| ||||||||||||| ||||| || ||| |||||||||||||||| |
|
|
| T |
20159459 |
accttgagattacaaggctaggctctaaccactgaactagcacctcaagtgta |
20159511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University