View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14148_low_17 (Length: 221)
Name: NF14148_low_17
Description: NF14148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14148_low_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40404564 - 40404349
Alignment:
| Q |
1 |
tgacaaatgcatagtagatccaaagcattgcactgaaaagtgccacaacataaggaagtgcctgaaatccttcagcagatttcttcttgaagattacgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404564 |
tgacaaatgcatagtagatccaaagcattgcactgaaaagtgccacaacataaggaagtgcctgaaatccttcagcagatttcttcttgaagattacgta |
40404465 |
T |
|
| Q |
101 |
aaaagttggcctgcaannnnnnnnnnnnnnnnnnncgtttaggaaatta-----tcacttcactttgttcaattaatttacaagaaaacaaaatggttac |
195 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40404464 |
aaaagttggcctgcaa----------atatatatacgtttagtaaattatcacttcacttcactttgttcaattaatttacaagaaaacaaaatggttac |
40404375 |
T |
|
| Q |
196 |
ttacaatggtgagaggaacaccgcaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40404374 |
ttacaatggtgagaggaacaccgcaa |
40404349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 45317739 - 45317632
Alignment:
| Q |
8 |
tgcatagtagatccaaagcattgcactgaaaagtgccacaacataaggaagtgcctgaaatccttcagcagatttcttcttgaagattacgtaaaaagtt |
107 |
Q |
| |
|
|||||| |||||||||||||||||||| || | ||| ||||||||||| || ||||| ||||||| ||||||||||||| ||||| |||||| ||| |
|
|
| T |
45317739 |
tgcataatagatccaaagcattgcactcaacaatgcagtaacataaggaactgattgaaacccttcagtagatttcttcttgtagattcggtaaaatgtt |
45317640 |
T |
|
| Q |
108 |
ggcctgca |
115 |
Q |
| |
|
|| ||||| |
|
|
| T |
45317639 |
ggtctgca |
45317632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University