View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1414_high_6 (Length: 221)
Name: NF1414_high_6
Description: NF1414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1414_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 5 - 198
Target Start/End: Complemental strand, 42560863 - 42560670
Alignment:
| Q |
5 |
atgtataggatggctgtctaatgtcgattactctccctctaccaaatcctagacttgttcatataactgttatagtttgatattaatattgtggcatttg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42560863 |
atgtataggatggctgtctaatgtcgattactctccctctaccaaatcctagacttgttcatataactgttatagtttgatattaatattatggcatttg |
42560764 |
T |
 |
| Q |
105 |
agtgtgtattaaagtggccaattcactttagcttggctggagtggtggggagtaaaatcttgcttccctcaattgttggggatttagaggagag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42560763 |
agtgtgtattaaagtggccaattcactttagcttggctggagtggtgaggagtaaaatcttgcttccctcaattgttggggatttagaggagag |
42560670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University