View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1414_low_11 (Length: 243)
Name: NF1414_low_11
Description: NF1414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1414_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 32206034 - 32206261
Alignment:
| Q |
1 |
ttgataatggatacaataaggtatgtacatctcttcaaaatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagattta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32206034 |
ttgataatggatacaataaggtatgtatatctcttcaaaatatatctatcattcatcttttagattttgatgcatatgacatgaaccaagtatagattta |
32206133 |
T |
|
| Q |
101 |
tataatggattgtagtcataattagc-nnnnnnnnttggtcgaattgctacggatgcaactcattctgcacgagggcgtaatatttagctgacaaagatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32206134 |
tataatggattgtagtcataattagcaaaaaaaatttggtcgaattgctaaggatgcaactcattctgcacgagggcgtaatatttagctgacaaagatt |
32206233 |
T |
|
| Q |
200 |
agtcaaatttgtaagatgtgatgtaact |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32206234 |
agtcaaatttgtaagatgtgatgtaact |
32206261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University