View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1414_low_12 (Length: 237)
Name: NF1414_low_12
Description: NF1414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1414_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 32852652 - 32852858
Alignment:
| Q |
15 |
tgatgatggattatccaataagaactgaaatgtactcacgctttactgaataggtatgcgttccccctccgacaatgaaacgcctgaaagaagggtgatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852652 |
tgatgatggattatccaataagaactgaaatgtactcacgctttactgaataggtatgcgttccccctccgacaatgaaacgcctgaaagaagggtgatc |
32852751 |
T |
|
| Q |
115 |
aaagattattaggatgatacaataatccagcagagaagttggaaacttcaagcgttttgtactggcaaaaaaccaagaaatatcattgaaagacactgct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852752 |
aaagattattaggatgatacaataatccagcagagaagttggaaacttcaagcgttttgtactggcaaaaaaccaagaaatatcattgaaagacactgct |
32852851 |
T |
|
| Q |
215 |
acagaat |
221 |
Q |
| |
|
||||||| |
|
|
| T |
32852852 |
acagaat |
32852858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University