View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1414_low_13 (Length: 225)
Name: NF1414_low_13
Description: NF1414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1414_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 24 - 187
Target Start/End: Complemental strand, 15141452 - 15141290
Alignment:
| Q |
24 |
atatatatcattatttttctttatctgaaaagaacaaaatatgaatatattatgtccactagaaggcatcaccacctttcaataaaatccaaacctcatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15141452 |
atatatatcattatttttctttatctgaaaagaacaaaatatgaatatattatgtccactagaaggcatcaccacctttcaataaaatccaaacctcatt |
15141353 |
T |
 |
| Q |
124 |
caattgttttgtagcccccaacaccactttccttttgcttacatcactcttttcagaataatct |
187 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
15141352 |
caattg-tttgtagcccccaacaccactttccttgtgcttacatcactcttttcagagtaatct |
15141290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University