View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1414_low_16 (Length: 221)
Name: NF1414_low_16
Description: NF1414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1414_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 25 - 137
Target Start/End: Complemental strand, 44547423 - 44547311
Alignment:
| Q |
25 |
cacccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttgaacctgaggaccaacctccacttgcattgtagcttcaccgaaatct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44547423 |
cacccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttgaacctgaggaccaatctccacttgcattgtagcttcaccgaaatct |
44547324 |
T |
|
| Q |
125 |
gttacagtattat |
137 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
44547323 |
gttatagtattat |
44547311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 44547501 - 44547447
Alignment:
| Q |
25 |
cacccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttga |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547501 |
cacccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttga |
44547447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 44547576 - 44547525
Alignment:
| Q |
28 |
ccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttga |
79 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| ||||||||||| |
|
|
| T |
44547576 |
ccttcctagctcttgagcatgaggaccagctaccacccttcctagctcttga |
44547525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 44547741 - 44547687
Alignment:
| Q |
25 |
cacccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttga |
79 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| || ||||||||||| |
|
|
| T |
44547741 |
cacccttcctagctcttgagtctgaggaccagccaccaccattcctagctcttga |
44547687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 44548023 - 44547969
Alignment:
| Q |
25 |
cacccttcctagctcttgatcttgaggaccagctaccaccctttctagctcttga |
79 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||| ||||||||| |||||| |||| |
|
|
| T |
44548023 |
cacccttcctatctcttgagcctgaggaccagccaccacccttcctagcttttga |
44547969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 91
Target Start/End: Complemental strand, 44547437 - 44547393
Alignment:
| Q |
47 |
tgaggaccagctaccaccctttctagctcttgaacctgaggacca |
91 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| | ||||||||| |
|
|
| T |
44547437 |
tgaggaccagccaccacccttcctagctcttgatcttgaggacca |
44547393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University