View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1414_low_18 (Length: 210)
Name: NF1414_low_18
Description: NF1414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1414_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 41150299 - 41150113
Alignment:
| Q |
18 |
attaagagtgttgtgttatctagagaaataaaaatatgtaccttgaattggtgatgacgtgggaaatcaaaggactggggaatgaagcagagtccatagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41150299 |
attaagagtgttgtgttatctagagaaataaaaatatgtaccttgaattggtgatgacgtgggaaatcaaaggaccggggaatgaagcagagtccatagg |
41150200 |
T |
 |
| Q |
118 |
cagtgatatcaaattttctattcttagaaaattgaaggaaaga------atgtactcaaaaattgtgttcttaattatttcatctcac |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41150199 |
cagtgatatcaaa-tttctattcttagaaaattgaaggaaagaaaaagtatgtactcaaaaattgtgttcttaattatttcatgtcac |
41150113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University