View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_high_27 (Length: 384)
Name: NF14151_high_27
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_high_27 |
 |  |
|
| [»] scaffold0012 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0012 (Bit Score: 96; Significance: 6e-47; HSPs: 3)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 194 - 297
Target Start/End: Original strand, 151024 - 151127
Alignment:
| Q |
194 |
tggttaaacgaaaaaacgattccaagttttgtaaccaatcgaaataagttaaaacataaatttactaacttcaatgaaatagacatattagctcatgttc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
151024 |
tggttaaacgaaaaaacgattccaagttttgtaaccaatcgaaataaattaaaacataaatttactaacttcaatgaaatagacatatttgctcatgttc |
151123 |
T |
 |
| Q |
294 |
caaa |
297 |
Q |
| |
|
|||| |
|
|
| T |
151124 |
caaa |
151127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 63 - 143
Target Start/End: Original strand, 150931 - 151011
Alignment:
| Q |
63 |
caactagtaaaatacatgtgcgtaaacgttcttactgtttaagtttgttattattgaagtatgaactaaaaatgttgacaa |
143 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
150931 |
caactagtaaaatacatgtgcataaacgttcttactgtataagtttgttattattgaagtatgaactataaacgttgacaa |
151011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 151
Target Start/End: Original strand, 167161 - 167190
Alignment:
| Q |
122 |
tatgaactaaaaatgttgacaaacaatata |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
167161 |
tatgaactaaaaatgttgacaaacaatata |
167190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 27715190 - 27715239
Alignment:
| Q |
300 |
ctacaacttgattctctgaacaaaatgcaaggactgatgtaacactaata |
349 |
Q |
| |
|
|||| ||| |||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
27715190 |
ctaccactcgattctctaaataaaatgcaaggactgatgtaatactaata |
27715239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University