View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_high_30 (Length: 319)
Name: NF14151_high_30
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 48081120 - 48081422
Alignment:
| Q |
1 |
acatgatacacgtagatacctcataactcggcaaatatatttcatctatcggatatctgcaaagatatagagcgaacacaaatatcgtttttatgcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48081120 |
acatgatacacgtagatacctcataactcgtcaaatatattccatctatcggatatctgcaaagatatagagcgaacacaaatatcgtttttatgcaaca |
48081219 |
T |
|
| Q |
101 |
gtgtcaactgccaacaaatgactacaaaaattagtgacactggaggagggtagctgtgacgaataccatggtatttatgttgaacacatgcacaattata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48081220 |
gtgtcaactgccaacaaatgactacaaaaattagtgacactggaggagggtagctgtgacgaataccatggtatttatgttgaacacatgcacaattata |
48081319 |
T |
|
| Q |
201 |
tctgtctgctcgtcgtccctaccaccttattgaattattgttttagagggaaaacacttcgttatttctttaaatcatgtttagctcaaaagggactaat |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48081320 |
tctgtctgctcgtcgtccctaccacctaattgaattattgttttagagggaaaacacttcgttatttctttaaatcatgtttagctcaaaagggactaat |
48081419 |
T |
|
| Q |
301 |
atg |
303 |
Q |
| |
|
||| |
|
|
| T |
48081420 |
atg |
48081422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University