View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_high_43 (Length: 238)
Name: NF14151_high_43
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_high_43 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 48177370 - 48177154
Alignment:
| Q |
17 |
aacattttataagccacctaatactaaactgtcatgtgcgtgtgnnnnnnnaaaggaagttcttnnnnnnncccatggtccaaatgcaacataacttaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48177370 |
aacattttataagccacctaatactaaactgtcatgtgcgtgtgtttttttaaaggaagttcttaaaaaaacccatggtccaaatgcaacataacttaa- |
48177272 |
T |
|
| Q |
117 |
taagatgaatatgaagaaaacaatgttatttgccacgaaggaacatttcatcaatcagtcacgagcacacatgacatgttttttgttttgattacgctag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48177271 |
---gatgaatatgaagaaaacaatgttatttgccacgaaggaacctttcatcaatcagtcacgagcacacatgacatgt-ttttgttttgattacgctag |
48177176 |
T |
|
| Q |
217 |
taattatgatttttgtcatccc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48177175 |
gaattatgatttttgtcatccc |
48177154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University