View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_low_3 (Length: 630)
Name: NF14151_low_3
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 591; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 591; E-Value: 0
Query Start/End: Original strand, 13 - 615
Target Start/End: Original strand, 43805223 - 43805825
Alignment:
| Q |
13 |
attatactaatggcaaaaaatggagaaacagtggctgcttttgaacggttctggtaaagactaactgggggcttgaagttgtcaaccaattattaaaatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805223 |
attatactaatggcaaaaaatggagaaacagtggctgcttttgaacggttctggtaaagactaactgggggcttgaagttgtcaaccaattattaaaatg |
43805322 |
T |
 |
| Q |
113 |
ttatcaaaacttcttttcatcttatctaccaccactttgcttatgaaaaatcagaagcagcctcattttcatcgaaaacatgtttctttcatcccttccc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805323 |
ttatcaaaacttcttttcatcttatctaccaccactttgcttatgaaaaatcagaagcagcctcattttcatcgaaaacatgtttctttcatcccttccc |
43805422 |
T |
 |
| Q |
213 |
ctgtttctcattttcacactcatcttcattctctccgccatcaccttgttcctccgtcgtaaacaaccaaaatatgaccggagacaaccaccaggtccac |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805423 |
ctgtttctcattttcacactcatcttcattctctccgccatcaccttgttcctccgtcgtaaacaaccaaaatatgaccggagacaaccaccaggtccac |
43805522 |
T |
 |
| Q |
313 |
ggggatatccagtcatcggtaacctccacatgctgggtactctcccacaccgtgcactccaagccttgtccaaaaaacacggtcctatcatgttactacg |
412 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805523 |
ggggatatccagtcatcggtaacctccacttgctgggtactctcccacaccgtgcactccaagccttgtccaaaaaacacggtcctatcatgttactacg |
43805622 |
T |
 |
| Q |
413 |
tttaggacaggtcccaacaatcattgtctcttcctcttcagcagcagaacaattcctcaaaacacacgacgttgttttctcttcccgtccaaaacttgaa |
512 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805623 |
tttaggacaagtcccaacaatcattgtttcttcctcttcagcagcagaacaattcctcaaaacacacgacgttgttttctcttcccgtccaaaacttgaa |
43805722 |
T |
 |
| Q |
513 |
gccacccattatctttcttatggttctaaagggttggtttttgctgaatacggtgcctattggcgtaatatgaggaaggtttgcactttgcagcttttaa |
612 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805723 |
gccacccattatctttcttatggttctaaagggttggtttttgctgaatacggtgcctattggcgtaatatgaggaaggtttgcactttgcagcttttaa |
43805822 |
T |
 |
| Q |
613 |
gtg |
615 |
Q |
| |
|
||| |
|
|
| T |
43805823 |
gtg |
43805825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University