View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_low_34 (Length: 317)
Name: NF14151_low_34
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 299
Target Start/End: Complemental strand, 4389585 - 4389293
Alignment:
| Q |
8 |
ccaagaatatattttccttttattgggaattcagatatgttgggccaataaagctaaaaccaggaggcttaacgtgtctttcccttgttttaataactcc |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389585 |
ccaagaatatattttccctttattgggaattcagatatgttgggccaataaagctaaaaccagaaggcttaacgtgtctttcccttgttttaataactcc |
4389486 |
T |
 |
| Q |
108 |
caattcatgccctagttcataacacttggagggttcaacagtttttgcagaagcattttcaactttcaacatacttcataggctatccttatcactttct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389485 |
caattcatgccctagttcataacacttggagggttcaacagtttttgcagaagcattttcaactttcaacatacttcataggctatccttatcactttct |
4389386 |
T |
 |
| Q |
208 |
cgagacagcaaat-gcatcacaccataaagaatcgatcttcaatgaatggcatgagttttgtgtgaaccaaaactctagccgactccatagat |
299 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4389385 |
cgagacagcaaatggcatcacaccataaagaatcgatcttcaatgaatggcatgagttttgtgtgaaccaaaactctagctgactccatagat |
4389293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University