View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_low_35 (Length: 303)
Name: NF14151_low_35
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 4485089 - 4484925
Alignment:
| Q |
18 |
caaagctcaagttcctatcatatcctttgcagcacctaccataaccccaccgttgatgaataatcgatggccttttctggtgagactagctaacaatggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4485089 |
caaagctcaagttcctatcatatcctttgcagcacctaccattaccccacctttgatgaataatcgatggccttttctagtgagactagctaacaatggt |
4484990 |
T |
 |
| Q |
118 |
acgacatacataaaatgcattgcagaaatagtgcatgcttattgctggaagagagtagtagtaat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4484989 |
acgacatacataaaatgcattgcagaaatagtgcatgcttattgctggaagagagtagtagtaat |
4484925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 284
Target Start/End: Complemental strand, 4489256 - 4488990
Alignment:
| Q |
18 |
caaagctcaagttcctatcatatcctttgcagcacctaccataaccccaccgttgatgaataatcgatggccttttctggtgagactagctaacaatggt |
117 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| |||||||| |||||||| |||||| | ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4489256 |
caaagctcaagttccagtcatatcctttgtagctcctaccattaccccaccattgatggaagctcggtggccttttctggtgagactagctaacactggt |
4489157 |
T |
 |
| Q |
118 |
acgacatacataaaatgcattgcagaaatagtgcatgcttattgctggaagagagtagtagtaatctacaaagatgatgggtatggtggagattatggga |
217 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||| ||||| | ||||| ||||||||||| |||| |
|
|
| T |
4489156 |
acagcatatataaaatgcattgcagaaatagtgcaggcttatagctggaagaaagtagtagtaatctacgaagataacgggtacggtggagattacggga |
4489057 |
T |
 |
| Q |
218 |
tgctaaccctgttacgtgaagcccttcaagatgtggattcaatgattgagcactgcttaatccttcc |
284 |
Q |
| |
|
||||| | ||| || ||| || ||||| || ||||| |||||||| |||||| ||||| ||||||| |
|
|
| T |
4489056 |
tgctagctctgctagctgaggcacttcaggacgtggactcaatgatcgagcaccgcttagtccttcc |
4488990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 179 - 287
Target Start/End: Complemental strand, 4484127 - 4484019
Alignment:
| Q |
179 |
taatctacaaagatgatgggtatggtggagattatgggatgctaaccctgttacgtgaagcccttcaagatgtggattcaatgattgagcactgcttaat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4484127 |
taatctacaaagatgatgggtatggtggagattatgggatgctaaccctgttaggtgaagcccttcaagatgtggattcaatgattgagcactgcttaat |
4484028 |
T |
 |
| Q |
279 |
ccttccctt |
287 |
Q |
| |
|
||||||||| |
|
|
| T |
4484027 |
ccttccctt |
4484019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University