View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_low_38 (Length: 272)
Name: NF14151_low_38
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 48176854 - 48176592
Alignment:
| Q |
1 |
ttcttgttagaacaactctacaaaagatttacgaaataataagcgcaaccaatgaacttacgatctttgttaacgaaattaatttggctaattgtgccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176854 |
ttcttgttagaacaactctacaaaagatttacgaaataataagcgcaaccaatgaacttacgatctttgttaacgaaattaatttggctaattgtgccaa |
48176755 |
T |
 |
| Q |
101 |
cgttaccgattatcaaggccatgcgcaagggtgggtctcacctccgcttgttcgtccctgcccacttgccggtacctatgaggaatatctaacatactca |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176754 |
cgttaccgattgtcaaggccatgcgcaagggtgggtctcacctccgcttgttcgtccctgcccacttgccggtacctatgaggaatatctaacatactca |
48176655 |
T |
 |
| Q |
201 |
acagttctacttcta---ccattctataatcagtaatagtggttccaacgatgttctgtgatg |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176654 |
acagttctacttctacttccattctataatcagtaatagtggttccaacgatgttctgtgatg |
48176592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University