View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14151_low_46 (Length: 230)
Name: NF14151_low_46
Description: NF14151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14151_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 3362297 - 3362081
Alignment:
| Q |
1 |
tgtttcattaattatttaatttatggatacaagtggtgttggtatgcactattttaattgttgtttgtgtgagtcattgaatgcatttgtggtttttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3362297 |
tgtttcattaattatttaatttatggatacaagtggtgttggtatgcactattttaattgttgtttgtgtgaatcattgaatgcatttgtggtttttgga |
3362198 |
T |
|
| Q |
101 |
attggaagcagtaatgtcattgaagaagaacaagaacaagatgttggtttggtttcacttgtactttctccattgatcacattatttatttatt----ta |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3362197 |
attggaagcagtaatctcattgaagaagaacaagaacaagatgttggtttggtttcacttgtactttctccattgatcacattatttatttatttattta |
3362098 |
T |
|
| Q |
197 |
ttcctttttgttctctg |
213 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3362097 |
ttcctttttgttctctg |
3362081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University