View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_high_22 (Length: 384)
Name: NF14152_high_22
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 173 - 377
Target Start/End: Original strand, 7128535 - 7128739
Alignment:
| Q |
173 |
ctgttttcttgttgttgtacttgactggtaacatgaaaaactgatattgttcgtgttcatgtaaaaacgaataatttgaatttatgagtctttcattatt |
272 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128535 |
ctgttttcttgatgttgtacttgtctggtaacatgaaaaactgatattgttcgtgttcatgtaaaaacgaataatttgaatttatgagtctttcattatt |
7128634 |
T |
|
| Q |
273 |
aatttattttgtgaaataattatctaactcagatgtgacgactttggtgattttttgtattgcagataaattatggtgaacattcagaagctagagtaat |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7128635 |
aatttattttgtgaaataattatctaactcagatgtgacgactttggtgattttttgtattgcagataaattatggggaacattcagaagctagagtaat |
7128734 |
T |
|
| Q |
373 |
ctgtg |
377 |
Q |
| |
|
||||| |
|
|
| T |
7128735 |
ctgtg |
7128739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University