View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_high_34 (Length: 355)
Name: NF14152_high_34
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 21481752 - 21482014
Alignment:
| Q |
1 |
gaatgtaaaatatgaaaatcggtttgaaccaaccacggtttaacccgaggattcacaattcaattagttgaatgggatgagtttagtctggttttttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21481752 |
gaatgtaaaatatgaaaatcggtttgaaccaaccacggtttaacccgaggattcacaattcaatgagttgaacgggatgagtttagtctggttttttaaa |
21481851 |
T |
|
| Q |
101 |
actttggtttgatctcgattcaattacgccgggaactaggaaatccaaatccatgaaaattaagtaaaagaaaacattataagagaaggctcttacaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21481852 |
actttggtttgatctcgattcaattacgccgggaactaggaaatccaaatccatgaacattaagtaaaagaaaacattataagagaaggctcttacaaat |
21481951 |
T |
|
| Q |
201 |
ttgccacacttcacatcagaatatatcactatgaaatctccttcttggagaccattagctttc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21481952 |
ttgccacacttcacatcagaatatatcactatgaaatctccttcttggagtccattagctttc |
21482014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University