View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_high_43 (Length: 272)
Name: NF14152_high_43
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 47591371 - 47591601
Alignment:
| Q |
1 |
ttcacttgattctctctctcaatcactcacccaatgcagtttactacactaactgacactgtagtacacatgcacacaaagccaactggcaaatattgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591371 |
ttcacttgattctctctctcaatcactcactcaatgcagtttactacactaactgacactgtagtacacatgcacacaaagccaactggcaaatattgat |
47591470 |
T |
 |
| Q |
101 |
ttcattcacataaagataaaataagaaggcgaaaggagtgagtaaagggacaaacagtttacaaattctagtgttattcgtttgtttctctctctctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47591471 |
ttcattcacataaagataaaataagaaggcgaaaggagtgagtaaagggacaaacagtttacaaattctagtgtgattcgtttgtttctctctctctttt |
47591570 |
T |
 |
| Q |
201 |
tgccactttatgttatgttaaatgttaatca |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
47591571 |
tgcctctttatgttatgttaaatgttaatca |
47591601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University