View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_high_53 (Length: 232)
Name: NF14152_high_53
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_high_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 57 - 214
Target Start/End: Original strand, 39951238 - 39951395
Alignment:
| Q |
57 |
atagcttttgtttttagctgtggcttttacagtaagaattgatgcgtatttcttatctgacgatactgagttttggttgcattcatagctgatcctggag |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39951238 |
atagcttttgtttttagctgtggcttttacagtaagacttgatgcgcatttcttatctgacgatactgagttttggttgcagtcatagctgatcctggag |
39951337 |
T |
 |
| Q |
157 |
ggggtatcttctatactgatcgaagaaaccagcaggggggcatgtgctagctcatgcg |
214 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39951338 |
gtggtatcttcattactgatcgaagaaaccagcaggggggcatgtgctagctcatgcg |
39951395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 39950884 - 39950937
Alignment:
| Q |
1 |
tggtgagatgttactcatagagtagtatagagttgccttccgttgcaatatcgt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39950884 |
tggtgagatgttactcatagagtagtatagagttgccttccgttgcaatatcgt |
39950937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 59 - 213
Target Start/End: Original strand, 46402616 - 46402769
Alignment:
| Q |
59 |
agcttttgtttttagctgtggcttttacagtaagaattgatgcgtatttcttatctgacgatactgagttttggttgcattcatagctgatcctggaggg |
158 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||| ||||||| || ||||| ||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
46402616 |
agctttagttttaagctgtggcttttat--taagaccagatgcgtcttgcttatgtgatgatactgagttttggttgcagtcatagctgatccaggaggt |
46402713 |
T |
 |
| Q |
159 |
ggtatcttctatactgat-cgaagaaaccagcaggggggcatgtgctagctcatgc |
213 |
Q |
| |
|
||||| ||| ||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46402714 |
ggtatgttcattactgatccaaagaaaccagcaggggggcatgtgctagctcatgc |
46402769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 46402247 - 46402298
Alignment:
| Q |
1 |
tggtgagatgttactcatagagtagtatagagttgccttccgttgcaatatc |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
46402247 |
tggtgagatgttactcatagagtggtatagagtttccttccgttgcaatatc |
46402298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University