View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_high_59 (Length: 212)
Name: NF14152_high_59
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_high_59 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 36134638 - 36134849
Alignment:
| Q |
1 |
aacacattatgccacctgatgtaaatatctctaatttacttgtttatatataagaaaaagactcgatgaaaatcatgacattccatcacaaatcaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36134638 |
aacacattatgccacctgatgtacatatctttaatttacttgtttatatataagaaaaagactcgatgaaaatcatgacattccatcacaaatcaatatt |
36134737 |
T |
|
| Q |
101 |
tgttacaatgcacgttcatatatagtttgcaatgttttgttttatacatgcatgatttcagtttaatatattgatggtttgagtgatctgaatattgtta |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
36134738 |
tgttacaatgcatgttcatatatagtttgcaatgttttgtgttatacatgcatgattccagttaaatatatcgatcgtttgagtgatctgaatattgtta |
36134837 |
T |
|
| Q |
201 |
gcgatttctaat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36134838 |
gcgatttctaat |
36134849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University