View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_46 (Length: 313)
Name: NF14152_low_46
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 17057877 - 17057658
Alignment:
| Q |
1 |
cctaggtttcaatatctatagcgtttgattcttagccctagttatttggtgcatgatttgatttgannnnnnnnatcttgttttttgcaggacaataatt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17057877 |
cctaggttccaatatctatagcgtttgattcttagccctagttatttggtgcattatttgattt-----tttttatcttgttttttgcaggacaataatt |
17057783 |
T |
|
| Q |
101 |
atgttctatgcagatttagaaagaattgcactcacttacctgtaagcaaaaatatcgttgcacaagataaaccaagaaagatagtcgttcctgaacctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17057782 |
atgttctatgcagatttagaaagaattgcactcacttacctgtaagcaaaaatatcgttgcacaagataaaccaagaaagatagtcgttcctgaacctgc |
17057683 |
T |
|
| Q |
201 |
ggcaatcaccatacctgtaagttac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
17057682 |
ggcaatcaccatacctgtaagttac |
17057658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 246 - 304
Target Start/End: Complemental strand, 17057661 - 17057603
Alignment:
| Q |
246 |
ttaccaaaagatttgatggttttattcctatactgtattattattgtttttctcctttg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17057661 |
ttaccaaaagatttgatggttttattcctatactgtattattattgtttttctcgtttg |
17057603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 81 - 127
Target Start/End: Original strand, 6044892 - 6044938
Alignment:
| Q |
81 |
ttttttgcaggacaataattatgttctatgcagatttagaaagaatt |
127 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
6044892 |
ttttttgcaggacaacaattatgttctatgcaaattcagaaagaatt |
6044938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 81 - 126
Target Start/End: Complemental strand, 22598487 - 22598442
Alignment:
| Q |
81 |
ttttttgcaggacaataattatgttctatgcagatttagaaagaat |
126 |
Q |
| |
|
||||||| ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
22598487 |
ttttttgtaggccaacaattatgttctatgcagatttagaaagaat |
22598442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 81 - 130
Target Start/End: Complemental strand, 17637460 - 17637411
Alignment:
| Q |
81 |
ttttttgcaggacaataattatgttctatgcagatttagaaagaattgca |
130 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
17637460 |
ttttttgcaggccaacaattatgttctatgcagatttcaaaagaattgca |
17637411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University