View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_53 (Length: 258)
Name: NF14152_low_53
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 2205482 - 2205603
Alignment:
| Q |
100 |
caacaatgtcttgccac-tgtgaaaccagaacataacgactttagagtttcaccctcaaaagcatgccactgcgtgcgaagttgtgatcattatggaaga |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2205482 |
caacaatgtcttgccacctgtgaaaccagaacataacgactttagagtttcaccctcaaaatcatgccactgcgtgccaagttgtgatcattatggaaga |
2205581 |
T |
 |
| Q |
199 |
gggcctcatcaaaacaacaaat |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2205582 |
gggcctcatcaaaacaacaaat |
2205603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 2205412 - 2205465
Alignment:
| Q |
1 |
ccaaggccaagcaatggagttccaattctcaaagtaaagattgatttgttgcat |
54 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2205412 |
ccaagtccaagcaatggatctccaattctcaaagtaaagattgatttgttgcat |
2205465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University