View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_56 (Length: 250)
Name: NF14152_low_56
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 26053682 - 26053448
Alignment:
| Q |
1 |
agaccctctaccatgtttagtgtgtttgagtaaacctttcaaaatattaacgtctgcagcaacgctgctgcaatggggatgagaagaggatgagcttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26053682 |
agaccctctaccatgtttagtgtgtttgagtaaacctttcaaaatatgaacgtctgcagcaacgctgctgcaatggggatgagaagaggacgagcttcta |
26053583 |
T |
|
| Q |
101 |
ttgacaatgagttgtggtgtcgttgcaaacagcaatgatttgaaacatgatatcgacacccccatattttacattactccacatcattgaaattgggttt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| |||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26053582 |
ttgacaatgagttgtggtgtcgctgcgaacagtgatgatttggaacatgcaatcgacgcccccatattttacattactccacatcattgaaattgggttt |
26053483 |
T |
|
| Q |
201 |
ggattgacccgaaaatggattcagtaggaaaatag |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26053482 |
ggattgacccgaaaatggattcattaggaaaatag |
26053448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 26073735 - 26073501
Alignment:
| Q |
1 |
agaccctctaccatgtttagtgtgtttgagtaaacctttcaaaatattaacgtctgcagcaacgctgctgcaatggggatgagaagaggatgagcttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26073735 |
agaccctctaccatgtttagtgtgtttgagtaaacctttcaaaatatgaacgtctgcagcaacgctgctgcaatggggatgagaagaggacgagcttcta |
26073636 |
T |
|
| Q |
101 |
ttgacaatgagttgtggtgtcgttgcaaacagcaatgatttgaaacatgatatcgacacccccatattttacattactccacatcattgaaattgggttt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| |||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26073635 |
ttgacaatgagttgtggtgtcgctgcgaacagtgatgatttggaacatgcaatcgacgcccccatattttacattactccacatcattgaaattgggttt |
26073536 |
T |
|
| Q |
201 |
ggattgacccgaaaatggattcagtaggaaaatag |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26073535 |
ggattgacccgaaaatggattcattaggaaaatag |
26073501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University