View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_57 (Length: 250)
Name: NF14152_low_57
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_57 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 116 - 250
Target Start/End: Complemental strand, 27756441 - 27756307
Alignment:
| Q |
116 |
tcatgttaatgatgcttctttgcctattgtatgagctagttgaaaattccctaaagtattaccattagaaaactatcaaactcaacaaacaaggtgtttc |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27756441 |
tcatgttaataatgcttctttgcctattgtatgagctagttgaaaattccccaaagtattaccattagaaaactatcaaactcaacaaacaaggtgtttc |
27756342 |
T |
 |
| Q |
216 |
tatatctaagtaaacatgattattctatttcagta |
250 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||| |
|
|
| T |
27756341 |
tacatctaagtaaatgtgattattctatttcagta |
27756307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 27756639 - 27756538
Alignment:
| Q |
13 |
aaaatcctaagaagataagtggactagatgaaactattgcagtcttccaatttctgaaacaagtaagaaatgatgttatcagaggaaagtagaatacaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
27756639 |
aaaatcctaagaagataagtggactagatgaaactattgcagtcttccaatttctgaagcaagcaagaaatgatgttataagaggaaactagaatacaat |
27756540 |
T |
 |
| Q |
113 |
at |
114 |
Q |
| |
|
|| |
|
|
| T |
27756539 |
at |
27756538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 116 - 195
Target Start/End: Original strand, 46225904 - 46225983
Alignment:
| Q |
116 |
tcatgttaatgatgcttctttgcctattgtatgagctagttgaaaattccctaaagtattaccattagaaaactatcaaa |
195 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
46225904 |
tcatgttaataatgctttctttcctattgtatgagctagtaaaaaattccctaacatattacctttagaaaactatcaaa |
46225983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University