View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_61 (Length: 230)
Name: NF14152_low_61
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 49869441 - 49869253
Alignment:
| Q |
23 |
gcggggatttgaactacggaccttgagccaagctattatgaatttgtacttatcaattgagccaagctcacggagacaaactagtttatttatttggaat |
122 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49869441 |
gcggggatttgaactccggaccttgt----atctattatgaatttgtacttatcaattgagccaagctcacggagacaaactagtttatttatttggaat |
49869346 |
T |
 |
| Q |
123 |
taagctccaaagatgaataaaatttgcttccaaactt-cnnnnnnnggtatccggagtttgaacccatttgattgcaggacctaagctcaaag |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49869345 |
taagctccaaagatgaataaactttgcttccaaacttattttttttggtatccggagtttgaacccatttgatcgcaggacctaagctcaaag |
49869253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University