View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14152_low_61 (Length: 230)

Name: NF14152_low_61
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14152_low_61
NF14152_low_61
[»] chr3 (1 HSPs)
chr3 (23-214)||(49869253-49869441)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 49869441 - 49869253
Alignment:
23 gcggggatttgaactacggaccttgagccaagctattatgaatttgtacttatcaattgagccaagctcacggagacaaactagtttatttatttggaat 122  Q
    ||||||||||||||| |||||||||     | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49869441 gcggggatttgaactccggaccttgt----atctattatgaatttgtacttatcaattgagccaagctcacggagacaaactagtttatttatttggaat 49869346  T
123 taagctccaaagatgaataaaatttgcttccaaactt-cnnnnnnnggtatccggagtttgaacccatttgattgcaggacctaagctcaaag 214  Q
    ||||||||||||||||||||| |||||||||||||||         ||||||||||||||||||||||||||| |||||||||||||||||||    
49869345 taagctccaaagatgaataaactttgcttccaaacttattttttttggtatccggagtttgaacccatttgatcgcaggacctaagctcaaag 49869253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University