View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_64 (Length: 221)
Name: NF14152_low_64
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 28 - 210
Target Start/End: Complemental strand, 52023016 - 52022834
Alignment:
| Q |
28 |
actcgacaacagcagaagaaacgcgccatggtgaaaggcgttatcggagaagaaacccgattccaatcggttgaggatcgtctcaccaaatcttcccctc |
127 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
52023016 |
actcaacaacagcagaagaaacgcaccatggtgaaaggcgttgtcggagaagaaacccgattccaatcggttgaagatcgtctcaccaaatcttcctctc |
52022917 |
T |
|
| Q |
128 |
cagctgaggtgggtctactgataggaaaattcagctccgcattggatcgcgtctttctcttcgatttgattccaactcctccc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52022916 |
cagctgaggtgggtctactgataggaaaattcagctccgcattggatcgcgtctttctcttcgatttgattccaactcctccc |
52022834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University