View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14152_low_67 (Length: 211)
Name: NF14152_low_67
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14152_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 50 - 197
Target Start/End: Original strand, 47116985 - 47117128
Alignment:
| Q |
50 |
caatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaaca |
149 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116985 |
caatatcaacgtatcaatgactcga----tcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaaca |
47117080 |
T |
|
| Q |
150 |
aagctcaacgggaacgccaacatcatcatcttcgccggtgatgatgtc |
197 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
47117081 |
aagctcaacgggaacgccaacatcaccgtcttcaccggtgatgatgtc |
47117128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University