View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14154_high_12 (Length: 258)

Name: NF14154_high_12
Description: NF14154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14154_high_12
NF14154_high_12
[»] chr4 (2 HSPs)
chr4 (145-218)||(20410102-20410175)
chr4 (16-60)||(20409973-20410017)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 145 - 218
Target Start/End: Original strand, 20410102 - 20410175
Alignment:
145 ccttgaagcagaatattcatcttcttcaatggtggtgttctttcactaatcaggtacgtttttctctcaattca 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20410102 ccttgaagcagaatattcatcttcttcaatggtggtgttctttcactaatcaggtacgtttttctctcaattca 20410175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 20409973 - 20410017
Alignment:
16 aaattcttcgtcttcaatggtgttcatcgaacactaatcaggtac 60  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
20409973 aaattcttcgtcttcaatggtgttcatcgaacactaatcaggtac 20410017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University