View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14154_high_14 (Length: 239)
Name: NF14154_high_14
Description: NF14154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14154_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 26833653 - 26833879
Alignment:
| Q |
1 |
aatggcacgatcaatggctctctgatttgtctccaacgaaactcgagttgtaaaccaagtccattccttgctccttgaaaagcatacannnnnnnacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26833653 |
aatggcacgatcaatggctctctgatttgtctccaaagaaactcgtgttgtaaaccaagtccattccttgctccttgaaaagcatacatttttttacttc |
26833752 |
T |
 |
| Q |
101 |
aaatgnnnnnnngaataaatttaaccaactttacttaaagaaaaggagaaaaacttgtttttgtttcca-gggtcatgcagaaaagaaactgtggaagag |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
26833753 |
aaatgtttttttgaataaatttaaccaactttacttaaagaaaaggagaaaaacttgtttttgtttccaggggtcatgcagaaaagaaactgtgaaagag |
26833852 |
T |
 |
| Q |
200 |
gtagaaaaattaacaaaacgttgatat |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26833853 |
gtagaaaaattaacaaaacgttgatat |
26833879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University