View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14154_high_19 (Length: 226)
Name: NF14154_high_19
Description: NF14154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14154_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 22 - 200
Target Start/End: Complemental strand, 3657048 - 3656870
Alignment:
| Q |
22 |
ttgtattcaagaaatcatgagcctgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatccttgtagaggaagatattat |
121 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3657048 |
ttgtattaaagaaatcacgagcctgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatccttgtagaggaagatattat |
3656949 |
T |
 |
| Q |
122 |
tacaaatccattatttgaatggtagaagagggaatgacgaaatggatcgtctaccttccccgcgggaaaggtatgcctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3656948 |
tacaaatccattatttgaatggtagaagagggaatgacgaaatggatcgcctaccttccccgcgggaaaggtatgcctt |
3656870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 3649049 - 3648840
Alignment:
| Q |
20 |
ttttgtattcaagaaatcatgagcctgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatccttgtagaggaagatatt |
119 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||| ||||| |
|
|
| T |
3649049 |
ttttgtattaaagaaatcatgagcgtgtctgcattgacaatagggtcatcttcattgtcgaaaatattattacagattcatggttgcaaaggaaaatatt |
3648950 |
T |
 |
| Q |
120 |
attacaaatccat--------------tatttgaatggtagaagagggaatgacgaaatggatcgtctaccttccccgcgggaaaggtatgccttatagc |
205 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3648949 |
gttacaaatccattatatttggtttaatatttgaatggtagaagaggg-atgacgaaatggatcgtctaccttccccgtgggaaaggtatgccttatagc |
3648851 |
T |
 |
| Q |
206 |
gtctgtgctcc |
216 |
Q |
| |
|
|| | |||||| |
|
|
| T |
3648850 |
gtttctgctcc |
3648840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 3644477 - 3644423
Alignment:
| Q |
18 |
aattttgtattcaagaaatcatgagcctgtctgcattgacaatagggtcatcttc |
72 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
3644477 |
aattttgtattatagaaagcatgagcctctctgcactgacaaaagggtcatcttc |
3644423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University