View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14154_low_10 (Length: 271)
Name: NF14154_low_10
Description: NF14154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14154_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 37064399 - 37064161
Alignment:
| Q |
16 |
ctctcttccttggttgacttaagtgttagctccgattttctgaccggtaatattccaaccagcattggaaaactctttaatttgaagagtttggtcattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37064399 |
ctctcttccttggttgacttaagtgttagctccgattttctgaccggtaatattccaaccagcattggaaaactctttaatttgaagagtttggtcattg |
37064300 |
T |
|
| Q |
116 |
gaggaagttccttgtcaggtgttctatctgaaatacatttttccaatctctctagtttagaaacattggtcttgagtgcactgatttcatttgatatgga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37064299 |
gaggaagttccttgtcaggtgttctatctgaaatacatttttccaatctctctagtttagaaacattggtcttgagtgcaccgatttcatttgatatgga |
37064200 |
T |
|
| Q |
216 |
ttctaaatggattcctccatttcaattgaacgggataag |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37064199 |
ttctaaatggattcctccatttcaattgaacgggataag |
37064161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University