View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14154_low_12 (Length: 258)
Name: NF14154_low_12
Description: NF14154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14154_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 145 - 218
Target Start/End: Original strand, 20410102 - 20410175
Alignment:
| Q |
145 |
ccttgaagcagaatattcatcttcttcaatggtggtgttctttcactaatcaggtacgtttttctctcaattca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20410102 |
ccttgaagcagaatattcatcttcttcaatggtggtgttctttcactaatcaggtacgtttttctctcaattca |
20410175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 20409973 - 20410017
Alignment:
| Q |
16 |
aaattcttcgtcttcaatggtgttcatcgaacactaatcaggtac |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20409973 |
aaattcttcgtcttcaatggtgttcatcgaacactaatcaggtac |
20410017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University