View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14154_low_13 (Length: 242)
Name: NF14154_low_13
Description: NF14154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14154_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 3914456 - 3914563
Alignment:
| Q |
119 |
ctcctaggtggacatatccctcacgagctttgaaagctatcttctttacttgacttgtaagtattgtttctttgaactttcatttttattggtatttgtt |
218 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||| ||||| || ||||||||||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
3914456 |
ctcctaagtggacatatccctcccgagcttggaaagcttacttctctatttgacttgtaagtattgtttctttgaagtttcacttttattggtatctgtt |
3914555 |
T |
|
| Q |
219 |
gtagtttt |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
3914556 |
gtagtttt |
3914563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 4 - 94
Target Start/End: Original strand, 50127957 - 50128047
Alignment:
| Q |
4 |
gtatgaagtttcaataatatgggtgaaagatgagtacttagtggatacaattcgtgataaagaaaagggaagaattttaaaacttgactcc |
94 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||| ||||||||||| ||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
50127957 |
gtatgaagtttcaatagtgtgggtgaaagatgggtacctagtggatacagttcgtgatagagaaaagggaagaattataaaacttgactcc |
50128047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 4 - 97
Target Start/End: Complemental strand, 11761564 - 11761471
Alignment:
| Q |
4 |
gtatgaagtttcaataatatgggtgaaagatgagtacttagtggatacaattcgtgataaagaaaagggaagaattttaaaacttgactccatt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| || ||||||| ||| |||||| ||||||||||||||||||||||||| ||| |||| |
|
|
| T |
11761564 |
gtatgaagtttcaataatatgggtgaaagatgggtacctaatggatacgatttgtgatagagaaaagggaagaattttaaaacttaacttcatt |
11761471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 34959966 - 34959919
Alignment:
| Q |
1 |
ggagtatgaagtttcaataatatgggtgaaagatgagtacttagtgga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34959966 |
ggagtatgaagtttcaataatatgggtgaaagatgagtacctagtgga |
34959919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 93 - 171
Target Start/End: Complemental strand, 34959890 - 34959808
Alignment:
| Q |
93 |
ccattgggggtttcacacatgacaaactcctaggtggacatat----ccctcacgagctttgaaagctatcttctttacttga |
171 |
Q |
| |
|
||||||| ||||||||||| |||| | ||||| |||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
34959890 |
ccattggtggtttcacacaggacagattcctaagtggacatatatatccctcacgagcttggaaagctttcttctttacttga |
34959808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 190 - 226
Target Start/End: Complemental strand, 34959811 - 34959775
Alignment:
| Q |
190 |
ttgaactttcatttttattggtatttgttgtagtttt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34959811 |
ttgaactttcatttttattggtatttgttgtagtttt |
34959775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University