View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_high_17 (Length: 255)
Name: NF14155_high_17
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 39 - 237
Target Start/End: Complemental strand, 25108185 - 25107991
Alignment:
| Q |
39 |
ggtacaggagcaatagcaacttgcatgcatgtatggttgtattcttagattagaatcttgaaccagtatttaattatattgaaacatatgcatatgcatg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25108185 |
ggtacaggagcaatagcaacttgcatgcatgtatggttgtattcttagattagaatcttaaaccagtatttaattatattgaagcatatgcatatg---- |
25108090 |
T |
 |
| Q |
139 |
ttcattcaaagaaagtaagacatggattctataatccggtcattcaaagtatatcaattaataaagcataaacttttgtgtatgatatcatggaattgg |
237 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25108089 |
ttcgttcaaagaaagtaagacatggattctataatccggtcattcaaagtatattaattaataaagcataaacttttgtgtatgatatcatggaattgg |
25107991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 135
Target Start/End: Complemental strand, 13234474 - 13234409
Alignment:
| Q |
70 |
tatggttgtattcttagattagaatcttgaaccagtatttaattatattgaaacatatgcatatgc |
135 |
Q |
| |
|
|||||||||||||||||||| |||| || || | |||||| |||||||||| ||||| ||||||| |
|
|
| T |
13234474 |
tatggttgtattcttagattggaatattaaatcgatatttagttatattgaatcatatacatatgc |
13234409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University