View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_high_21 (Length: 214)
Name: NF14155_high_21
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 42683076 - 42682870
Alignment:
| Q |
1 |
agtagagaaatctcacattctgtgttagcttgtctggtattccatatccttaaaccaaaaaccaatattgcaattgaaacaaacaatgttaagatgttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42683076 |
agtagagaaatctcacattctgtgttagcttgtctggtattccatatccttaaaccaaaaaccaatattgcaattgaaacaaacaatgttaagacgttca |
42682977 |
T |
 |
| Q |
101 |
cgatttggatcaagatgttgcataattgatcattcttgtatttgtcac-nnnnnnnnataatccatgtccttaatccctgggttggcttgttccattctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42682976 |
cgatttggatcaagatgttgcataattgaccattcttgtatttgtcactttttttttataatccatgttcttaatccctgggttggcttgttccattctt |
42682877 |
T |
 |
| Q |
200 |
gatgatg |
206 |
Q |
| |
|
||||||| |
|
|
| T |
42682876 |
gatgatg |
42682870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University