View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_low_14 (Length: 389)
Name: NF14155_low_14
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 21 - 382
Target Start/End: Original strand, 37596835 - 37597196
Alignment:
| Q |
21 |
tcaagatcccctactgctcacatataatttgatgggcacgtgagatgataattggctgcattggtgtgaatggtgtgcatgtaaggtcacaagatggcta |
120 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37596835 |
tcaagatccgctactgctcatttataattttatggccacgtgagatgataattggctgcattggtgtgaatggtgtgcatgtaaggtcacaagatgactt |
37596934 |
T |
 |
| Q |
121 |
tggcatttcccaaaccgaatactatgaatgaaggaaagtatccacttgaaattcctactttccgaaacaagccaccaccgttcattgatgatgcaaatct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37596935 |
tggcatttcccaaaccgaatactatgaatgaaggaaagtatccacttgaaattcctactttccgaaacaagccaccaccgttcattgatgctgcaaatct |
37597034 |
T |
 |
| Q |
221 |
catgtttttgaaatgcctgcactgcaatgcttctcttccactttctttcttctcaacatgcaccaataaaaagtaggccccactcaaagacaatgttagt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37597035 |
catgtttttgaaatgcctgcactgcaatgcttctcttccactttctttcttctcaacatgcaccaataaaaagtaggccccactcaaagacaatggtagt |
37597134 |
T |
 |
| Q |
321 |
cccacaaacccatcacatctttctttccaccgtccacctcatacgattcgattcctttgctt |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37597135 |
cccacaaacccatcacatctttctttccaccgtccacctcatacaattcgattcctttgctt |
37597196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University