View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14155_low_15 (Length: 377)
Name: NF14155_low_15
Description: NF14155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14155_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 38170550 - 38170877
Alignment:
| Q |
1 |
cgttttggttttagtccctgtaaannnnnnnngttgattttggtccctggaaatatgtctcgtttttatttacctttagtttcgtggtaatttgttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38170550 |
cgttttggttttagtccctgtaaattttttttgttgtttttggtccctggaaatatgtctcgtttttgtttacctttagtttcgtggtaatttgttttct |
38170649 |
T |
|
| Q |
101 |
gtatgtgctgatgatcattcttcttctttattacattgtttttaagaagtagtaatattttgatgtgatggg-atgggatattgaaatatgatttaaagt |
199 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38170650 |
gtatgtgctgat---cattcttcttcttcattacattgtttttaagaagtagtaatattttgatgtgatggggatgggatattgaaatatgatttaaagt |
38170746 |
T |
|
| Q |
200 |
ttgtgtaaagttggtactaactgaagtatgtggctaaattggtgaaaataattgtttcatgtttgacacgacacgacacggacacagatgattcaattat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
38170747 |
ttgtgtaaagttggtactaactgaagtatgtggctaaattggtcaaaataattgtttcatgttt-----gacacgacacggacacatatgattcaattat |
38170841 |
T |
|
| Q |
300 |
gtcatttgttcaaattattcacaatgtcaactagtt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38170842 |
gtcatttgttcaaattattcacaatgtcaactagtt |
38170877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 51 - 189
Target Start/End: Complemental strand, 38452310 - 38452173
Alignment:
| Q |
51 |
aaatatgtctcgtttttatttacctttagtttc--gtggtaatttgttttctgtatgtgctgatgatcattcttcttctttattacattgtttttaagaa |
148 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38452310 |
aaatatgtcttgtttttgtttacctttagtttctcgtggtaatttgttttctgtatgtgctgat---cattcttcttctttattacattgtttttaagaa |
38452214 |
T |
|
| Q |
149 |
gtagtaatattttgatgtgatgggatgggatattgaaatat |
189 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
38452213 |
gtagtaatattttgatgtgatgggatgagatattaaaatat |
38452173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 71
Target Start/End: Complemental strand, 36973697 - 36973664
Alignment:
| Q |
38 |
ttttggtccctggaaatatgtctcgtttttattt |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
36973697 |
ttttggtccctggaaatatgtctcgttttgattt |
36973664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 11925749 - 11925785
Alignment:
| Q |
35 |
tgattttggtccctggaaatatgtctcgtttttattt |
71 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
11925749 |
tgattttggtccctgcaaatatgtctcgttttgattt |
11925785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 38232251 - 38232287
Alignment:
| Q |
35 |
tgattttggtccctggaaatatgtctcgtttttattt |
71 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
38232251 |
tgattttggtccctgcaaatatgtctcgttttgattt |
38232287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University